If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Circular RNA Ubiquitin-associated Protein 2 Silencing Suppresses Bladder Cancer Progression by Downregulating DNA Topoisomerase 2-alpha Through Sponging miR-496
Circular RNAs (circRNAs) have been uncovered to be implicated in the malignant development of bladder cancer (BC).
Objective
Herein, this work aimed to investigate the role and mechanism of circRNA ubiquitin-associated protein 2 (circUBAP2) in BC progression.
Design, setting, and participants
Quantitative real-time polymerase chain reaction and Western blotting were used for the detection of genes and proteins.
Outcome measurements and statistical analysis
In vitro functional experiments were conducted using colony formation, 5-ethynyl-2′-deoxyuridine (EdU), Transwell, wound healing, and flow cytometry assays, respectively. A glycolysis analysis was conducted by assessing glucose uptake and lactate production. A murine xenograft model was established to perform in vivo experiments. The binding interaction between miR-496 and circUBAP2 or DNA topoisomerase 2-alpha (TOP2A) was verified using a dual-luciferase reporter assay.
Results and limitations
CircUBAP2 was highly expressed in BC patients, and high circUBAP2 expression showed a shorter survival rate. Functionally, knockdown of circUBAP2 could suppress BC cell growth, migration, invasion, and aerobic glycolysis in vitro, as well as impede BC growth in nude mice. Mechanistically, circUBAP2 acted as a sponge for miR-496, which targeted TOP2A. Moreover, circUBAP2 could indirectly regulate TOP2A expression through sequestering miR-496. Furthermore, a series of rescue experiments showed that miR-496 inhibition reversed the anticancer action of circUBAP2 knockdown on BC cells. Moreover, miR-496 could attenuate BC cell malignant phenotypes and aerobic glycolysis, which were abolished by TOP2A overexpression.
Conclusions
Silencing of circUBAP2 could suppress BC growth, invasion, migration, and aerobic glycolysis by the miR-496/TOP2A axis, suggesting a promising target for the molecular targeted therapies of BC.
Patient summary
Circular RNA ubiquitin-associated protein 2 (circUBAP2) was found to be associated with poor prognosis in bladder cancer (BC). Knockdown of circUBAP2 might suppress BC growth, invasion, migration, and aerobic glycolysis, indicating that it may be a new target for the development of molecular targeted therapy for BC.
National Health Commission of the People’s Republic of China. Chinese guidelines for diagnosis and treatment of urothelial carcinoma of bladder 2018 (English version). Chin J Cancer Res 2019;31:49–66.
]. Until recently, the mainstream therapy of BC is limited to surgical resection and chemotherapy or immunotherapy; however, for patients with advanced BC who progress in devastatingly drug resistance or easily distant spread, the effects of these traditional therapies are unsatisfactory [
]. Hence, further elucidation on the underlying mechanism of BC pathogenesis is imperative for offering new therapeutic biomarkers for BC therapy.
Circular RNAs (circRNAs) are one of the noncoding RNAs with the continuous covalently closed loop organization that lack 5′ and 3′ ends; thus, unlike traditional linear RNAs, circRNAs are more stably expressed and difficult to be degraded by RNA exonuclease [
]. Functionally, circRNAs are revealed to be engaged in diverse pathological and physiological biological processes, such as proliferation, metastasis, apoptosis, and glucose metabolism [
]. Besides that, circRNAs have tremendous advantage as biological markers for disease due to the predominant cytoplasmic localization and the lack of free ends [
]. Currently, increasing reports have shown the abnormal expression of circRNAs in BC, and different circRNA transcripts exhibited the involvement in the tumorigenesis of BC as either tumor suppressors or oncogenes. For example, circRIP2 was demonstrated to perform oncogenic action in BC progression by positively regulating cell epithelial-mesenchymal transition through the miR-1305/Tgf-β2/smad3 pathway [
] showed that ectopic expression of circSLC8A1 suppressed BC cell proliferative, migratory, and invasive abilities by activating the PTEN pathway through sequestering miR-130b/miR-494. Besides, Xie’s team [
] suggested that circRNA BCRC-3 restrained BC proliferation via upregulating p27 through abolishing miR-182-5p. Circular RNA ubiquitin-associated protein 2 (circUBAP2; ID: hsa_circ_0003141) is generated from the ubiquitin-associated protein 2 (UBAP2) gene in chr9: 33953282-33973235 with the length of 536 bp. Hsa_circ_0003141 was found to be increased and associated with poor prognosis in hepatocellular carcinoma (HCC), besides that knockdown of circUBAP2 could restrain HCC progression by reducing cell growth and invasion by the miR-1827/UBAP2 axis [
]. Therefore, we speculated that circUBAP2 might also exert oncogenic function to promote BC progression.
Hence, this work focused on elucidating the expression profile of circUBAP2 in BC clinical sample, and the influences of circUBAP2 on BC prognosis and the tumorigenic phenotypes as well as aerobic glycolysis of BC cells. It has been proposed that circRNAs can act as sponges for microRNA (miRNA/miR) to eliminate miRNA-induced inhibition of the levels of mRNAs, namely the competitive endogenous RNA (ceRNA) mechanism [
]. Herein, whether circUBAP2 exerted its function on the miRNA/mRNA axis was also investigated.
2. Patients and methods
2.1 Clinical tissue specimens
In total, 41 pairs of BC tissues and matched normal tissues were collected from patients who had undergone radical cystectomy at the Affiliated Huaian No.1 People's Hospital of Nanjing Medical University between January 2015 and March 2019, and immediately stored at –80°C until use. All BC patients were newly diagnosed by pathological examination and did not receive any preoperative therapy. All the patients were followed up on a regular basis; overall survival time was analyzed from the date of surgery to the date of death or the date of the last follow-up visit for survivors. The follow-up deadline was January 2020. Written informed consent was collected from all participants before specimen collection, and this study was authorized by the Ethics Committee of the Affiliated Huaian No.1 People's Hospital of Nanjing Medical University.
2.2 Cell culture
BC cell lines (RT4, T24, UMUC3, J82, and SW780) and uroepithelial cell line SV-HUC-1 were obtained from COBIOER (Nanjing, China) and cultured in RPMI-1640 medium (Gibco, Carlsbad, CA, USA) comprising 10% fetal bovine serum (FBS; Gibco) at 37°C with 5% CO2.
2.3 Reverse transcription and quantitative real-time polymerase chain reaction
Total RNA was extracted using TRIzol reagent (Takara, Dalian, China). First-strand cDNA was generated by reverse transcription with the PrimeScript RT Reagent Kit (Takara), and then SYBR QPCR Mix (Takara) was employed to carry out a quantitative real-time polymerase chain reaction (qRT-PCR) analysis. The relative fold changes were shown as a cycle threshold (Ct) value and normalized to β-actin or U6.
2.4 Actinomycin D treatment and RNase R digestion
The culture medium of J82 and SW780 cells was added with actinomycin D (2 mg/ml) or dimethyl sulfoxide (Sigma-Aldrich, St. Louis, MO, USA) to block the de novo RNA synthesis. Besides, total RNA (5 μg) was hatched with or without 3 U/μg RNase R (Sigma-Aldrich) at 37°C for 15 min. Finally, the abundance of circUBAP2 and linear UBAP2 was examined using qRT-PCR (Table 1).
Table 1Primer sequences used for qRT-PCR
Name
Primers for qRT-PCR (5′-3′)
circUBAP2
Forward
CAACAATCAGATGGCACCAGG
Reverse
CACGTCCAAATCCAGGCTCT
miR-496
Forward
GCCGAGTGAGTATTACATGGCC
Reverse
CTCAACTGGTGTCGTGGAG
β-actin
Forward
TGGATCAGCAAGCAGGAGTA
Reverse
TCGGCCACATTGTGAACTTT
U6
Forward
CTCGCTTCGGCAGCACATA
Reverse
CGAATTTGCGTGTCATCCT
UBAP2
Forward
CGAGAGCAGCAGCGATTTTC
Reverse
TGGTTGCGTTGATTGTGCTG
TOP2A
Forward
GGGAGAGTGATGACTTCCATATGGA
Reverse
AACACCTTCCCCAAACTAAATTCAG
circUBAP2 = circular RNA ubiquitin-associated protein 2; qRT-PCR = quantitative real-time polymerase chain reaction; TOP2A = DNA topoisomerase 2-alpha; UBAP2 = ubiquitin-associated protein 2.
Transient transfection in J82 and SW780 cells was performed by using the Lipofectamine 2000 reagent (Invitrogen, Camarillo, CA, USA). Short hairpin RNAs (shRNAs) targeting circUBAP2 (sh-circUBAP2) and nontarget shRNAs (sh-NC), pcDNA3.1 TOP2A overexpression plasmids (TOP2A) and empty pcDNA3.1 plasmids (pcDNA), miR-496 mimic (miR-496), inhibitor (in-miR-496), and the negative controls (miR-NC or in-miR-NC) were obtained from GeneChem (Shanghai, China). For animal experiments, lentivirus-mediated sh-circUBAP2, sh-NC, TOP2A, or pcDNA was procured from HanBio (Shanghai, China); the antagomiR-496 or the control (antagomiR-NC) was provided by Ambion (Shanghai, China). Puromycin was used to select stably downregulated cell lines.
2.6 Colony formation assay
After assigned transfection, J82 and SW780 cells were seeded into a six-well plate and cultured for 14 d at 37°C. Then cells were fixed with 4% paraformaldehyde and stained with 1% crystal violet (Solarbio, Beijing, China), and cell colonies (≥50 cells) were imaged and calculated using the microscope.
2.7 5-Ethynyl-2′-deoxyuridine assay
After all night culture in a 96-well plate, transfected J82 and SW780 cells were incubated with 50 μM 5-ethynyl-2′-deoxyuridine (EdU; RiboBio, Guangzhou, China) for 2 h at 37°C, fixed with 4% paraformaldehyde for 30 min, followed by treating with 2 mg/ml glycine for 5 min. Then each well was reacted with Apollo reaction mixture under darkness for 30 min. Cell nucleus was stained with DAPI. Lastly, five fields were randomly selected and visualized using a fluorescence microscope (Leica, Wetzlar, Germany), and EdU-positive cells were calculated.
2.8 Wound healing assay
Transfected J82 and SW780 cells were seeded in a six-well plate overnight to confluency. Then scratch wounds were made on the cell monolayers by a 200 μl pipette tip. The plate was washed by PBS to discard the suspended cells and then incubated in serum-free media with mitomycin C (6 μg/ml; Solarbio). The scratch was imaged at 0 and 24 h incubation, and wound closure was measured using Image J to assess cell migration.
2.9 Transwell assay
After transfection, J82 and SW780 cells in 200 μl FBS-free RPMI-1640 medium were seeded onto the upper chambers of Transwell inserts with 8-μm pore size membranes (Costar, Corning, Switzerland) or Matrigel-coated membrane (BD Biosciences, Franklin Lakes, NJ, USA) in a 24-well plate. RPMI-1640 with 10% FBS was added to the lower chamber; 24 h later, the migrated and invaded cells on the surface of the lower chamber were stained with 0.1% crystal violet (Solarbio), and then captured and counted by a microscope (100× magnification).
2.10 Flow cytometry
J82 and SW780 cells subjected to assigned transfection were harvested and then incubated with Annexin V-FITC and propodium iodide (BD Biosciences) in dark place for 15 min. Lastly, cell apoptosis was determined by using FACSCalibur flow cytometry (BD Biosciences).
2.11 Western blotting
Tissues and cells were lysed in RIPA lysis buffer (Beyotime, Shanghai, China) to extract total protein. The protein was separated by 10% SDS-PAGE and electrophoretically transferred onto PVDF membranes (0.2 μM, Beyotime). The membranes were probed with primary antibodies overnight at 4°C. Protein bands were quantified by an ECL reagent (Beyotime) after incubation with secondary antibody (D110058, 1:4000; Sangon Biotech) for 2 h, and the gray value was analyzed with Image J software. The primary antibodies included Bax (ab32503, 1:2000), Bcl-2 (ab182858, 1:2000), TOP2A (ab52934, 1:10000), and β-actin (ab8226, 1:1000; Abcam, Cambridge, MA, USA).
2.12 Measurements of glucose consumption and lactate production
After transfection, 2 × 105 J82 and SW780 cells were plated on a six-well plate with 1 ml RPMI-1640 containing 10% FBS and incubated for 24 h. Then the media were collected, and glucose consumption or lactate production was detected by using a Glucose Uptake Assay Kit or a lactate assay kit (Sigma-Aldrich).
2.13 Dual-luciferase reporter assay
Validation of the binding was performed by cloning partial circUBAP2 or TOP2A 3′-UTRs that contained the sequence recognized by the miR-496 seed sequence into psiCHECK-2 luciferase vector (Promega, Madison, WI, USA). Then J82 and SW780 cells were cotransfected with wild-type (WT) or mutated (MUT) recombinant plasmids (circUBAP2 WT/MUT or TOP2A 3′-UTR WT/MUT) together with miR-496 mimic or the control (miR-NC) using Lipofectamine 2000 reagent. Forty-eight hours later, a dual-luciferase reporter assay system (Promega) was employed to detect the Firefly and Renilla luciferase activities.
2.14 Animal experiments
This animal study was allowed by the Affiliated Huaian No.1 People's Hospital of Nanjing Medical University Animal Care and Use Committee, and implemented according to the guidelines of the National Institutes of Health. Five- to six-week-old BALB/c nude mice (n = 24) were obtained from Charles River Labs (Beijing, China) and kept under controlled conditions. The mice were divided into four groups (n = 6 per group). Approximately 6 × 106 SW780 cells stably transfected with lentivirus plasmids of sh-circUBAP2 or sh-NC were subcutaneously injected into the back of the mice. The xenografts were intratumorally injected with antagomiR-496, lentivirus-mediated TOP2A plasmids, or the control when the tumor grew to 100 cm3. The tumor size was measured every week, and the tumor volume was calculated by the following formula: volume = (length × width2)/2. After inoculation for 28 d, mice were euthanized, and xenograft tumors were peeled off, weighed, and fixed in formalin and embedded with paraffin for immunohistochemistry (IHC) staining as described previously [
], or harvested for qRT-PCR and Western blotting analysis.
2.15 Statistical analysis
The data were expressed as mean ± standard deviation. The comparisons were evaluated by an analysis of variance followed by Tukey’s post hoc test, or unpaired Student t test and Mann-Whitney U test. The expression correlation was assessed using Pearson’s coefficient analysis. A p vale of <0.05 indicated statistical significance.
3. Results
3.1 Circular RNA UBAP2 is elevated in BC and associated with poor prognosis and progression
To determine the expression profile of circUBAP2 in BC, qRT-PCR was executed to detect the expression levels of circUBAP2 in 41 pairs of BC tissues and adjacent nontumor tissues. The results showed that circUBAP2 expression was higher in BC tissues than those in normal tissues (Fig. 1A). Besides, the expression of circUBAP2 in BC tissues stratified by tumor size was determined; we found that the bigger tumors of BC (≥3 cm) showed higher circUBAP2 expression than the tumors smaller than 3 cm (Fig. 1B). The detailed information of BC patients is presented in Table 2. High circUBAP2 expression was associated with advanced T grade, lymph node metastasis, and bigger tumor size (p < 0.05; Table 2). Importantly, Kaplan-Meier survival curve revealed that a high circUBAP2 expression level was correlated with poor overall survival of patients with BC (Fig. 1B). Thereafter, we also observed increased expression of circUBAP2 in BC cell lines (RT4, T24, UMUC3, J82, and SW780) relative to the normal SV-HUC-1 cells (Fig. 1C). Then in order to examine the round structure of circUBAP2, actinomycin D and RNase R were adopted. The half-life of circUBAP2 exceeded 24 h, while that of linear UBAP2 was only about 4 h in J82 and SW780 cells after actinomycin D treatment (Fig. 1E and 1F). Moreover, RNase R, a 3′ to 5′ exoribonuclease, could rapidly degrade linear UBAP2 rather than circUBAP2 in J82 and SW780 cells (Fig. 1G and 1H). In all, circUBAP2 is a stable circRNA, and high expression of circUBAP2 was associated with poor prognosis and progression of BC.
Fig. 1CircUBAP2 is elevated in BC and associated with the poor prognosis and progression. (A) A qRT-PCR analysis of circUBAP2 expression in BC tissues and adjacent normal tissues. (B) A qRT-PCR analysis of circUBAP2 expression in BC tissues stratified by tumor size. (C) Kaplan-Meier survival curve of overall survival in 41 BC patients according to the circUBAP2 expression. (D) A qRT-PCR analysis of circUBAP2 expression in BC cell lines (RT4, T24, UMUC3, J82, and SW780) and normal SV-HUC-1 cells. (E–H) Actinomycin D and RNase R treatment were adopted to evaluate the stability of circUBAP2 in J82 and SW780 cells with linear UBAP2 as a control. * p < 0.05. BC = bladder cancer; circUBAP2 = circular RNA ubiquitin-associated protein 2; qRT-PCR = quantitative real-time polymerase chain reaction.
3.2 Knockdown of circUBAP2 suppresses BC cell oncogenic phenotypes and aerobic glycolysis in vitro
To investigate the biological function of circUBAP2 in BC cells, we constructed the RNAi vectors of circUBAP2 (sh-circUBAP2). A qRT-PCR analysis showed that circUBAP2 expression was significantly downregulated in J82 and SW780 cells after sh-circUBAP2 transfection (Fig. 2A). Functionally, cell colony formation and EdU assays showed that knockdown of circUBAP2 had obstructive effects on J82 and SW780 cell proliferation since the decrease of cell cloning capabilities and DNA synthesis activity upon circUBAP2 inhibition (Fig. 2B and 2C). In Transwell and wound healing assays, circUBAP2 silencing exerted similar repressing function on J82 and SW780 cell migration and invasion (Fig. 2D–F). The deficiency of circUBAP2 in flow cytometry gave rise to the enhancement of J82 and SW780 cell apoptosis, accompanied by a decrease of Bcl-2 and an increase of Bax in cells (Fig. 2G–I). Besides that, we probed the effect of circUBAP2 on glycolytic metabolism. It was proved that circUBAP2 silencing decreased glucose consumption and lactate production in J82 and SW780 cells (Fig. 2J and 2K). Taken together, circUBAP2 silencing could suppress proliferation, migration, invasion, and aerobic glycolysis, and induce apoptosis in BC cells.
Fig. 2Knockdown of circUBAP2 suppresses BC cell oncogenic phenotypes and aerobic glycolysis in vitro. J82 and SW780 cells were transfected with sh-circUBAP2 or sh-NC. (A) The level of circUBAP2 expression was detected using qRT-PCR after transfection. (B and C) Cell proliferation was analyzed using cell colony formation and EdU assays. (D and E) Transwell assay for cell migration and invasion. (F) Wound healing assay for cell migration. (G) Flow cytometry for cell apoptosis. (H and I) Western blotting analysis for the levels of Bax and Bcl-2 in cells. (J and K) Glucose consumption and lactate production were measured in cells using commercial kits. * p < 0.05. BC = bladder cancer; circUBAP2 = circular RNA ubiquitin-associated protein 2; EdU = 5-ethynyl-2′-deoxyuridine; qRT-PCR = quantitative real-time polymerase chain reaction; sh-circUBAP2 = short hairpin RNAs targeting circUBAP2; sh-NC = nontarget short hairpin RNAs.
3.3 Circular RNA UBAP2 acts as a sponge for miR-496 in BC cells
To explore the molecular mechanism underlying circUBAP2, the potential targets of circUBAP2 were predicted by using target prediction software Circbank, Starbase, and Circinteractome databases; the results of overlapping showed that circUBAP2 possesses conserved target sites of miR-496 and miR-589-5p (Fig. 3A). Moreover, knockdown of circUBAP2 led to a marked increase of miR-496 compared with miR-589-5p (Fig. 3B). Therefore, miR-496 might be a target of circUBAP2. The binding sites between circUBAP2 and miR-496 are shown in Figure 3C. The transfection efficiencies of miR-496 mimic and inhibitor were firstly detected. As expected, miR-496 expression was increased or decreased after miR-496 or in-miR-496 transfection in J82 and SW780 cells (Fig. 3D). Thereafter, results of a dual-luciferase reporter assay displayed that cotransfection of miR-496 mimic with WT circUBAP2 vector led to an overtly reduction of the luciferase activity in J82 and SW780 cells, while miR-496 overexpression failed to affect the luciferase activity in the MUT circUBAP2 vector (Fig. 3E and 3F), implying the binding between miR-496 and circUBAP2. It was discovered that miR-496 decreased in BC tissues (Fig. 3G), which was negatively correlated with circUBAP2 expression (Fig. 3H). Similarly, miR-496 expression was also lower in BC cells than in normal SV-HUC-1 cells (Fig. 3I). Moreover, the impact of circUBAP2 on miR-496 expression was measured. It was found that silencing of circUBAP2 caused an increase of miR-496 expression, while this condition was rescued by an miR-496 inhibitor (Fig. 3J). Altogether, circUBAP2 directly targeted miR-496 and suppressed its expression in BC cells.
Fig. 3CircUBAP2 acts as a sponge for miR-496 in BC cells. (A) The potential miRNAs of circUBAP2 predicted by Circbank, Starbase, and Circinteractome databases. (B) The effects of circUBAP2 knockdown on the expression of predicted miRNAs from the overlapping were detected by qRT-PCR. (C) The conserved target site of miR-496 on circUBAP2. (D) Transfection efficiencies of miR-496 mimic, inhibitor, and negative control were verified using qRT-PCR. (E and F) Dual-luciferase reporter assay for the luciferase activity of wild-type and mutated circUBAP2 reporter after miR-496 overexpression in J82 and SW780 cells. (G) A qRT-PCR analysis of miR-496 expression in BC tissues and adjacent normal tissues. (H) Pearson’s coefficient analysis for the correlation between miR-496 and circUBAP2 in BC tissues. (I) A qRT-PCR analysis of circUBAP2 expression in BC cell lines (J82 and SW780) and normal SV-HUC-1 cells. (J) The impact of circUBAP2 on miR-496 expression in J82 and SW780 cells analyzed using qRT-PCR. * p < 0.05. BC = bladder cancer; circUBAP2 = circular RNA ubiquitin-associated protein 2; miRNA = microRNA; MUT = mutated; qRT-PCR = quantitative real-time polymerase chain reaction; sh-circUBAP2 = short hairpin RNAs targeting circUBAP2; sh-NC = nontarget short hairpin RNAs; WT = wild type.
3.4 Knockdown of circUBAP2 suppresses BC cell oncogenic phenotypes and aerobic glycolysis by miR-496
To investigate whether circUBAP2 exerted its functions via the circUBAP2/miR-496 axis, rescue experiments were conducted by cotransfecting sh-circUBAP2 and in-miR-496 into BC cells. We demonstrated that miR-496 downregulation attenuated circUBAP2 knockdown-induced inhibition on cell proliferation (Fig. 4A and 4B), migration, and invasion (Fig. 4C–E) abilities, as well as promotion on cell apoptosis rate (Fig. 4F–H) in J82 and SW780 cells. Besides that, the decrease of both glucose consumption and lactate production mediated by circUBAP2 knockdown in J82 and SW780 cells were abolished by miR-496 downregulation (Fig. 4I and 4J). These results confirmed that circUBAP2 knockdown regulated BC cell malignant phenotypes and aerobic glycolysis by miR-496.
Fig. 4Knockdown of circUBAP2suppresses BC cell oncogenic phenotypes and aerobic glycolysis by miR-496. J82 and SW780 cells were transfected with sh-NC, sh-circUBAP2, sh-circUBAP2 + in-miR-NC, or sh-circUBAP2 + in-miR-496. (A and B) Cell proliferation was analyzed using cell colony formation and EdU assays. (C and D) Transwell assay for cell migration and invasion. (E) Wound healing assay for cell migration. (F) Flow cytometry for cell apoptosis. (G and H) Western blotting analysis for the levels of Bax and Bcl-2 in cells. (I and J) Glucose consumption and lactate production were measured in cells using commercial kits. * p < 0.05. BC = bladder cancer; circUBAP2 = circular RNA ubiquitin-associated protein 2; EdU = 5-ethynyl-2′-deoxyuridine; sh-circUBAP2 = short hairpin RNAs targeting circUBAP2; sh-NC = nontarget short hairpin RNAs.
3.5 TOP2A is a target of miR-496 and can be indirectly regulated by circUBAP2 in BC cells
According to the Starbase database, many of the genes were predicted to have a binding site on miR-496. Through the searching of previous researches, six genes that have been manifested to be related to the malignant progression of BC were selected. As shown in Supplementary Figures 1A and 1B, TOP2A was demonstrated to be negatively affected by miR-496. Therefore, we speculated that TOP2A might be a target of miR-496. TOP2A possesses a potential binding site of miR-496 (Fig. 5A). To validate the prediction, a dual-luciferase reporter assay was performed, and the results showed that miR-496 overexpression could significantly weaken the luciferase activity of WT TOP2A reporter vector but not the MUT one in J82 and SW780 cells (Fig. 5B and 5C), indicating that miR-496 targeted TOP2A in BC cells. TOP2A was found to be increased in BC tissues (Fig. 5D and 5E), and was negatively correlated with miR-496 expression (Fig. 5F) but positively correlated with circUBAP2 expression (Fig. 5G). Additionally, TOP2A expression was also elevated in BC cell lines (Fig. 5H). Thereafter, the effect of miR-496 on TOP2A expression was examined. We discovered that miR-496 mimic reduced TOP2A expression level in J82 and SW780 cells, which was reversed by the transfection of TOP2A overexpression plasmids (Fig. 5I). Importantly, circUBAP2 knockdown was accompanied with decreased TOP2A, which was subsequently upregulated by miR-496 inhibition in J82 and SW780 cells (Fig. 5J). In short, circUBAP2 could regulate the expression of TOP2A via acting as a ceRNA for miR-496 in BC.
Fig. 5TOP2A is a target of miR-496, and can be indirectly regulated by circUBAP2 in BC cells. (A) The potential binding site of miR-496 on TOP2A 3′-UTR. (B and C) Dual-luciferase reporter assay for the luciferase activity of wild-type and mutated TOP2A reporter after miR-496 overexpression in J82 and SW780 cells. (D and E) The qRT-PCR and Western blotting analyses of TOP2A expression in BC tissues and adjacent normal tissues. (F and G) Pearson’s coefficient analysis for the correlation between TOP2A and miR-496 or circUBAP2 in BC tissues. (H) Western blotting analysis of TOP2A expression in BC cell lines (J82 and SW780) and normal SV-HUC-1 cells. (I) The effects of miR-496 on TOP2A expression in J82 and SW780 cells were validated using western blotting. (J) The impacts of circUBAP2/miR-496 axis on TOP2A expression in J82 and SW780 cells were verified using Western blotting. * p < 0.05. BC = bladder cancer; circUBAP2 = circular RNA ubiquitin-associated protein 2; MUT = mutated; qRT-PCR = quantitative real-time polymerase chain reaction; sh-circUBAP2 = short hairpin RNAs targeting circUBAP2; sh-NC = nontarget short hairpin RNAs; TOP2A = DNA topoisomerase 2-alpha; WT = wild type.
3.6 MiR-496 restrains BC cell oncogenic phenotypes and aerobic glycolysis by TOP2A
Next, the action of miR-496/TOP2A axis in BC cells was elucidated. Colony formation and EdU assays suggested that the proliferative ability of J82 and SW780 cells was weakened upon miR-496 overexpression, while TOP2A upregulation could reverse miR-496–induced cell proliferation inhibition (Fig. 6A and 6B). In Transwell and wound healing assays, miR-496 upregulation reduced the migration and invasion rates in J82 and SW780 cells, and this phenomenon was counteracted by TOP2A vector transfection (Fig. 6C–E). A flow cytometric analysis implied that the apoptosis of J82 and SW780 cells was potentiated by miR-496 upregulation and subsequently suppressed in response to TOP2A vector (Fig. 6F). Moreover, the level of Bcl-2 was decreased, and the level of Bax was increased in J82 and SW780 cells after miR-496 mimic transfection, which was abolished by TOP2A overexpression (Fig. 6G and 6H). In glycolytic metabolism analysis, miR-496 overexpression reduced glucose consumption and lactate production in J82 and SW780 cells, and this effect was attenuated by TOP2A increase (Fig. 6I and 6J). Collectively, miR-496 restrained BC cell malignant phenotype and aerobic glycolysis by TOP2A.
Fig. 6MiR-496 restrains BC cell oncogenic phenotypes and aerobic glycolysis by TOP2A. J82 and SW780 cells were transfected with miR-NC, miR-496, miR-496 + pcDNA, or miR-496 + TOP2A. (A and B) Cell proliferation was analyzed using cell colony formation and EdU assays. (C and D) Transwell assay for cell migration and invasion. (E) Wound healing assay for cell migration. (F) Flow cytometry for cell apoptosis. (G and H) Western blotting analysis for the levels of Bax and Bcl-2 in cells. (I and J) Glucose consumption and lactate production were measured in cells using commercial kits. * p < 0.05. BC = bladder cancer; EdU = 5-ethynyl-2′-deoxyuridine; TOP2A = DNA topoisomerase 2-alpha.
3.7 Knockdown of circUBAP2 impedes tumor growth in vivo
To determine the functions of circUBAP2 on tumor growth in vivo, a murine xenograft model of BC was established using SW780 cells stably expressing lentivirus mediated sh-circUBAP2 or sh-NC. CircUBAP2 knockdown significantly suppressed xenograft growth in mice, manifested by the smaller and lighter xenografts in sh-circUBAP2 group compared with the sh-NC group (Fig. 7A and 7B). Moreover, circUBAP2 knockdown combined with antagomiR-496 or TOP2A plasmids led to an antagonistic promotion on tumor growth (Supplementary Fig. 2A–D). The levels of circUBAP2 and TOP2A were decreased, while miR-496 level was increased in xenograft tumors of sh-circUBAP2 group (Fig. 7C–G). Moreover, IHC staining showed that downregulation of circUBAP2 could decrease the expression of Ki-67 in xenograft tissues (Fig. 7G). These results confirmed that circUBAP2 silencing could suppress BC growth in vivo via miR-496 and TOP2A.
Fig. 7Knockdown of circUBAP2 impedes tumor growth in vivo. A murine xenograft model of BC was established using SW780 cells stably expressing lentivirus mediated sh-circUBAP2 or sh-NC. (A) Growth curves of mice subcutaneous xenograft tumors. (B) Representative xenograft tumors and tumor weights were statistically analyzed in dissected tumors on day 28. (C and D) A qRT-PCR analysis for circUBAP2 and miR-496 levels in xenograft tumors of each group. (E–G) TOP2A expression was detected in xenograft tumors of each group using qRT-PCR, Western blotting, and IHC analyses. (G) IHC staining for Ki-67 protein in xenograft tumors of each group. *p < 0.05. BC = bladder cancer; circUBAP2 = circular RNA ubiquitin-associated protein 2; IHC = immunohistochemistry; qRT-PCR = quantitative real-time polymerase chain reaction; sh-circUBAP2 = short hairpin RNAs targeting circUBAP2; sh-NC = nontarget short hairpin RNAs; TOP2A = DNA topoisomerase 2-alpha.
Molecular targeted therapy is a novel and revolutionized therapeutic strategy through interrupting specific biochemical pathway or specific molecules to impair tumor growth, metastasis, and development, and many molecular targeted therapies that have been approved by the Food and Drug Administration are being studied in clinical trials for the treatment of specific types of cancer [
]. Circular RNAs are abundantly expressed across species and have been considered as ideal noninvasive biomarkers for targeted clinical therapy owing to their structural stability, specificity, and accessibility [
]. In our study, we showed a significant increase of circUBAP2 in BC patients, and high expression of circUBAP2 was closely related to the poor outcome. Next, circUBAP2 was also confirmed to be abundant and stable in BC cells. Functionally, circUBAP2 deletion suppressed BC cell oncogenic phenotypes in vitro. Aerobic glycolysis, also named as the Warburg’s effect, is a phenomenon in which cells preferentially converts glucose to lactate to support higher energy requirement through the TCA cycle even in the presence of sufficient oxygen, which is characterized by the higher glucose consumption and lactate production [
]. Thereafter, we confirmed that knockdown of circUBAP2 led to the decrease of lactate production and glucose consumption in BC cells, indicating the suppression of aerobic glycolysis in BC cells after circUBAP2 silencing. Additionally, the clinical relevance of circUBAP2 in BC growth was also validated with the repression of xenograft tumor growth and Ki-67 protein in nude mice after circUBAP2 downregulation. Thus, silencing of circUBAP2 may impede BC progression.
It has been uncovered that circRNA can engage in regulating various biological approaches by binding with miRNAs to release the expression of downstream target mRNAs [
]. Thus, the underlying miRNA/mRNA axis of circUBAP2 was investigated. This study identified a circUBAP2/miR-496/TOP2A feedback loop in BC cells that circUBAP2 could indirectly regulate TOP2A expression through sequestering miR-496; miR-496 is a functional miRNA that has been reported to function as a tumor suppressor in several types of cancer, such as gastric, breast, and lung cancer [
Long noncoding RNA NNT-AS1 enhances the malignant phenotype of bladder cancer by acting as a competing endogenous RNA on microRNA-496 thereby increasing HMGB1 expression.
] showed that miR-496 could suppress BC cell growth and mobility through NT-AS1/miR-496/HMGB1 axis. Consistent with previous findings, this work also showed the inhibitory action of miR-496 on BC cell proliferative, invasive, and migratory abilities; moreover, miR-496 also restrained aerobic glycolysis in BC cells. Importantly, miR-496 inhibition attenuated the anticancer effects of circUBAP2 silencing on BC. TOP2A, a nuclear protein, is highly expressed in rapidly proliferating and growing cells, and the expression of TOP2A is cell cycle regulated, peaking in G2/M [
]. It is known that the malignant phenotypes of cancer, such as proliferation, metastasis, and chemotherapeutic drug resistance mediated by the deregulation of TOP2A, were induced mainly via regulation of DNA topological states and replication [
]. TOP2A has been discovered to be detected in many types of human malignancies at high levels and has become the primary cellular target for numerous chemotherapeutic drugs [
] showed that TOP2A induced epithelial-mesenchymal transition, in which tumor cells possess the potential of remote metastasis, in pancreatic cancer via activating β-catenin signaling pathway. TOP2A expression was verified to be associated with a shorter survival rate in BC and acted as an oncogene to promote BC progression [
]. In the current study, we also showed an increased expression level of TOP2A in BC; furthermore, TOP2A overexpression abolished the action of miR-496 on BC cell oncogenic phenotypes and aerobic glycolysis.
However, although some interesting results were found in this study, there are still some limitations. First, a larger cohort of the sample sizes is essential to verify the clinical value of circUBAP2 in BC. Besides, this conclusion should further be confirmed using the primary BC cells. Finally, the underlying pathway of TOP2A in BC cell oncogenic phenotypes still needs a further study.
5. Conclusions
In all, we for the first time demonstrated that circUBAP2 was associated with poor prognosis in BC, and knockdown of circUBAP2 might suppress BC oncogenic phenotype and aerobic glycolysis by the miR-496/TOP2A axis, indicating a new target for the development of molecular targeted therapy in BC.
Author contributions: Kun Liu had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.
Study concept and design: Fu.
Acquisition of data: Liu.
Analysis and interpretation of data: Zhao.
Drafting of the manuscript: Fu.
Critical revision of the manuscript for important intellectual content: Liu.
Statistical analysis: Jiang.
Obtaining funding: None.
Administrative, technical, or material support: Jiang.
Supervision: Wang.
Other: None.
Financial disclosures: Kun Liu certifies that all conflicts of interest, including specific financial interests and relationships and affiliations relevant to the subject matter or materials discussed in the manuscript (eg, employment/affiliation, grants or funding, consultancies, honoraria, stock ownership or options, expert testimony, royalties, or patents filed, received, or pending), are the following: None.
Funding/Support and role of the sponsor: None.
Appendix A. Supplementary data
The following are the Supplementary data to this article:
Supplementary Fig. 1Effects of miR-496 on the expression of predicted genes. The effects of miR-496 mimic on the expression of six predicted genes were detected by qRT-PCR. *P < 0.05.
Supplementary Fig. 2Effects of miR-496/TOP2A axis on the inhibition of circUBAP2 knockdown on BC tumor growth in vivo. A murine xenograft model of BC was established using SW780 cells stably expressing lentivirus mediated sh-circUBAP2 or sh-NC, and the xenografts were intratumorally injected with antagomiR-496 or lentivirus mediated TOP2A plasmids when the tumor grew to 100 cm3. (A, C) Growth curves of mice subcutaneous xenograft tumors. (B, D) Representative xenograft tumors, and tumor weights were statistical analyzed in dissected tumors at day 28. *P < 0.05.
National Health Commission of the People’s Republic of China. Chinese guidelines for diagnosis and treatment of urothelial carcinoma of bladder 2018 (English version). Chin J Cancer Res 2019;31:49–66.
Long noncoding RNA NNT-AS1 enhances the malignant phenotype of bladder cancer by acting as a competing endogenous RNA on microRNA-496 thereby increasing HMGB1 expression.
00095-2&id=gr1.jpg){kind=link}
00095-2&id=gr2.jpg){kind=link}
00095-2&id=gr3.jpg){kind=link}
00095-2&id=gr4.jpg){kind=link}
00095-2&id=gr5.jpg){kind=link}
00095-2&id=gr6.jpg){kind=link}
00095-2&id=gr7.jpg){kind=link}
00095-2&id=fx1.jpg){kind=link}
00095-2&id=fx2.jpg){kind=link}